Skip to main content

Advertisement

Table 1 Primers for the reverse transcription polymerase chain reaction (RT-PCR)

From: Selective inhibition of histone deacetylase 8 improves vascular hypertrophy, relaxation, and inflammation in angiotensin II hypertensive mice

Gene
(mouse or rat)
Primer sequence (5′ to 3′)
AT1 (mouse) F: GGAAACAGCTTGGTGGTGAT
R: GGCCGAAGCGATCTTACATA
ACE1 (mouse) F: CAGTGTCTACCCCCAAGCAT
R: TTCCATCAAAGACCCTCCAG
Nox1 (mouse) F: AGCCATTGGATCACAACCTC
R: TGGATGGGATTTAGCCAAGA
Nox2 (mouse) F: TGTCATTCTGGTGTGGTTGG
R: GAACCCCTGAGGAAGGAGAG
Nox4 (mouse) F: CTGGAAGAACCCAAGTTCCA
R: ACTGGCCAGGTCTTGCTTTA
p22phox (mouse) F: AAAGAGGAAAAAGGGCTCCA
R: CTGCCAGCAGGTAGATCACA
p47phox (mouse) F: ATCCCAACTACGCAGGTGAA
R: TATCTCCTCCCCAGCCTTCT
GATA6 (mouse) F: GAGGACCTGTCGGAGAGCCG
R: GCAAGTGGTCGAGGCACCCC
E2F3 (mouse) F: ATCCAAAGCTGTACCCTGGA
R: TGGGTACTTGCCAAATGGAT
iNOS (mouse) F: CTCACTGGGACAGCACAGAA
R: TGGTCAAACTCTTGGGGTTC
TNF-α (mouse) F: AGCCCCCAGTCTGTATCCTT
R: CTCCCTTTGCAGAACTCAGG
IL-1β (mouse) F: GCCCATCCTCTGTGACTCAT
R: AGGCCACAGGTATTTTGTCG
MCP-1 (mouse) F: AGGTCCCTGTCATGCTTCTG
R: TCTGGACCCATTCCTTCTTG
IL-6 (mouse) F: AGTTGCCTTCTTGGGACTGA
R: TCCACGATTTCCCAGAGAAC
Cox-2 (mouse) F: ATCCTGAGTGGGGTGATGAG
R: GGCAATGCGGTTCTGATACT
VCAM-1 (mouse) F: TCATCCCCACCATTGAAGAT
R: TGAGCAGGTCAGGTTCACAG
ICAM-1 (mouse) F: CCTGTTTCCTGCCTCTGAAG
R: TTAAGGTCCTCTGCGTCTCC
GAPDH (mouse) F: GCATGGCCTTCCGTGTTCCT
R: CCCTGTTGCTGTAGCCGTATTCAT
  1. F, forward; R, reverse